We try to keep things in simple terms so that it is easy to understand, but will provide links to more scientific detail for anyone that wants to explore further. [2][37], Ancient DNA identified as G-PF3359 has been found at archaeological sites in: Hungary (the subclade G-F872*), dated at 7,500 years before present (BP); Hungary (subclade G-F1193*) 7,150 BP, and; Spain (G-PF3359*) 4,700 BP.[2]. He came to London as an agent for his familys mineral trading business. B (M60), ancestor of men with haplogroup B, mostly in Africa. Steve Hissem, whose G-726 line goes back to the north of England. They had children including Friederich Phillipp Adolph, father of Alphons Adolph (1853-1934), who imvented the picture postcard, and: Wilhelm Adolph Adolph D (M174, including many early migrants to southern India and the Andaman Islands. He was ancestor of: John (Jack) Fletcher, whose ancestors were Furchers from Germany and who I know from genetic testing is a cousin of mine through several thousand years. FamilyTreeDNA Discover - Y-DNA Haplogroup G-FT15840 I have to say that I was very surprised when I got my results that I was not as Italian as I thought I was. Scholars have proposed dates ranging from 10,000 to 23,000 years ago for the origin of this group (Cinnioglu, Genographic Project, Semino). oneSignal_options['promptOptions'] = { }; In 2009-10, Family Tree DNA's Walk through the Y Project, sequencing certain Y-chromosome segments, provided a number of new G SNPs with the L designation. Very simple put, a Haplogroup is a marker of sorts that denotes a certain mutation at a certain time in history. This includes the Uralic-speaking Udmurts (10%) and Mordvins (7%), as well as the Karachay-Balkars (4.5%), Nogays (3.8%), North Ossetians (3.6%), Adyghe-Kabardin (3.6%) and Dargins (3.6%) in the North Caucasus, and the Latvians (3.5%) in the East Baltic. oneSignal_options['welcomeNotification']['message'] = ""; Powered by, Badges | So far, U2 has not been found among Ashkenazi Jews, Cypriots, Sardinians, Welsh, Icelandic, Saami, Lithuanians, Avars and Chuvash people. Genealogy Products and Services . [5] Cinnioglu et al. Elizabeth T Wood, Daryn A Stover, Christopher Ehret, L177, later discarded in favour of PF3359 and equivalent SNPs, was first identified at, International Society of Genetic Genealogy, List of genetic results derived from historical figures, Y-chromosome haplogroups in populations of the world, Y-DNA haplogroups in populations of Europe, Y-DNA haplogroups in populations of the Caucasus, Y-DNA haplogroups in populations of the Near East, Y-DNA haplogroups in populations of North Africa, "Distinguishing the co-ancestries of haplogroup G Y-chromosomes in the populations of Europe and the Caucasus", "Atlas of the Human Journey: Haplogroup G (M201)", "The Geographic Origins of Ethnic Groups in the Indian Subcontinent: Exploring Ancient Footprints with Y-DNA Haplogroups", "Late Pleistocene human genome suggests a local origin for the first farmers of central Anatolia", "Early farmers from across Europe directly descended from Neolithic Aegeans", "Ancient DNA suggests the leading role played by men in the Neolithic dissemination", "Ancient DNA from European Early Neolithic Farmers Reveals Their Near Eastern Affinities", "From surnames to the history of Y chromosomes: the Sardinian population as a paradigm", "Paleolithic Y-haplogroup heritage predominates in a Cretan highland plateau", "Y-chromosomal evidence of the cultural diffusion of agriculture in southeast Europe", "Y Chromosomal Evidence for a Limited Greek Contribution to the Pathan Population of Pakistan", "Polarity and temporality of high-resolution y-chromosome distributions in India identify both indigenous and exogenous expansions and reveal minor genetic influence of Central Asian pastoralists", "A prehistory of Indian Y chromosomes: Evaluating demic diffusion scenarios", "Dual Origins of the Japanese: Common Ground for Hunter-Gatherer and Farmer Y-Chromosomes", "Dissecting the influence of Neolithic demic diffusion on Indian Y-chromosome pool through J2-M172 haplogroup", "Isolates in a corridor of migrations: a high-resolution analysis of Y-chromosome variation in Jordan", "Chromosome Diversity Characterizes the Gulf of Oman", "The Druze: A Population Genetic Refugium of the Near East", "The Levant versus the Horn of Africa: Evidence for Bidirectional Corridors of Human Migrations", "Geographical Structure of the Y-Chromosomal Genetic Landscape of the Levant: A Coastal-Inland Contrast", "The place of the Basques in the European Y-chromosome diversity landscape", "A Back Migration from Asia to Sub-Saharan Africa Is Supported by High-Resolution Analysis of Human Y-Chromosome Haplotypes", "Kinship and Y-Chromosome Analysis of 7th Century Human Remains: Novel DNA Extraction and Typing Procedure for Ancient Material", "The genetic legacy of religious diversity and intolerance: paternal lineages of Christians, Jews, and Muslims in the Iberian Peninsula", http://ytree.ftdna.com/index.php?name=Draft&parent=20173662, "..Project Rosters - Haplogroup G Project", "Extended Y chromosome haplotypes resolve multiple and unique lineages of the Jewish priesthood", "Afghanistan's Ethnic Groups Share a Y-Chromosomal Heritage Structured by Historical Events", "The phylogeography of Y chromosome binary haplotypes and the origins of modern human populations", "New binary polymorphisms reshape and increase resolution of the human Y chromosomal haplogroup tree", http://ymap.ftdna.com/cgi-bin/gbrowse_details/hs_chrY?name=L240;class=Sequence;ref=ChrY;start=3191153;end=3191153;feature_id=40369, "Improved Resolution Haplogroup G Phylogeny in the Y Chromosome, Revealed by a Set of Newly Characterized SNPs", "Identification of the remains of King Richard III", "Results from the Hamman Family Y-Chromosome DNA Tests", "Haplogroup G2a (Y-chromosomal DNA) - Eupedia", Y-DNA Haplogroup G and its subclades from the current year ISOGG haplotree, https://en.wikipedia.org/w/index.php?title=Haplogroup_G-M201&oldid=1146500222, M201, PF2957, L116, L154, L204, L240, L269, L402, L520, L521, L522, L523, L605, L769, L770, L836, L837, M201, P257/U6, Page94/U17, U2, U3, U7, U12, U20, U21, U23, U33, Other males purported to be members of Haplogroup G include: German-American pioneer and soldier, This page was last edited on 25 March 2023, at 08:00. Does a haplogroup have to match exactly in order for another person to . An example is as follows, based on the one published at the end of my book In Search of Our Ancient Ancestors: from the Big Bang to Modern Britain, in Science and Myth. A "match" or a "not match" can mean different things. I did two tests, Living DNA and Ancestry.com. The forward primer is GTATTGAACTTACAATTCACGTCCC, and the reverse is CTCTCCAAATCGGGTTTCCT. Having received great feedback on my post Italian DNA Where Do We Come From? ":c;var d=[];Object.keys(a).forEach(function(e){var f=a[e],q=typeof f;"object"==q&&null!=f||"function"==q?d.push(r(f,b+e+c)):null!==f&&void 0!==f&&(e=encodeURIComponent(b+e),d.push(e+"="+encodeURIComponent(f)))});return d.filter(p).join("&")}function t(a,b){a||((window.__ATA||{}).config=b.c,m(b.url))}var u=Math.floor(1E13*Math.random()),v=window.__ATA||{};window.__ATA=v;window.__ATA.cmd=v.cmd||[];v.rid=u;v.createdAt=g();var w=window.__ATA||{},x="s.pubmine.com"; Haplogroup G Haplogroup G was the first branch of Haplogroup F outside of Africa. He was baptised on 3 February 1810 at Hachenburg with gdparents Wilhelm Adolph of Selbach, Adolph Fischer and Gertrude Fischer, hence his two christian names. "+a[1]:"")+a[2]}return a};var l=0;function m(a,b){var c=document.createElement("script");c.src=a;c.onload=function(){b&&b(void 0)};c.onerror=function(){b&&b("error")};a=document.getElementsByTagName("head");var d;a&&0!==a.length?d=a[0]:d=document.documentElement;d.appendChild(c)}function n(a){var b=void 0===b?document.cookie:b;return(b=h(b.split("; "),function(c){return-1!=c.indexOf(a+"=")}))?b.split("=")[1]:""}function p(a){return"string"==typeof a&&0Haplogroup Definition & Meaning | Dictionary.com Within Europe U4 is rarest in fringe regions such as Ireland (1.5%), Portugal (1.5%), north-west Spain (0.5%, except Cantabria which has 3%), Finland (1%), and especially among the Welsh, Sardinians and Saami, where it is completely absent. My y-chromosome is haplogroup G, or more specifically, haplogroup G2c, inherited from my grandfather Adolf Cramer, about which little is known. [4], Two scholarly papers have also suggested an origin in the Middle East, while differing on the date. Haplogroup U4 rarely exceeds 2% of the population of the Middle East and is completely absent from the Druzes of Syria, Lebanon and Palestine. G (CTS4803) Its chromosome location listed as 21653414. G-M201 has also been found in Neolithic Anatolian sites such as Boncuklu dating back to 8300-7600 BCE, and Barcin dating back to 6419-6238 BCE. Haplogroups are determined by a small number of mutations on the Y chromosome, known as Single Nucleotide Polymorphisms (SNPs), or Unique Event Polymorphisms (UEPs). Who probably lived in the Caucasus, and was ancestor of: G (P303) He died by 1835 and her death was recorded at Marienthal on 31 May 1803. A haplogroup is a genetic population group of people who share a common ancestor on the patriline or the matriline. If a sample meets the criteria indicated for these three markers, it is likely the sample is G2a2b1. Haplogroup G1is found predominantly in Iran, but is also found in the Levant, among Ashkenazi Jews, and in Central Asia (notably in Kazakhstan). One of the great things about My, Because of its location, Italy was invaded and conquered many times, as a result, very few people have pure Italian DNA. The Iceman belongs to haplogroup G2a2b [13] (earlier called G2a4). P257 was first reported in 2008. The SNP L497 encompasses these men, but most G-L497 men belong to its subclade G-Z725, also known as G-DYS388=13. The members of G-PF3359 are probably smaller in number than men included in G-P303, but only a small amount of testing has occurred for the relevant mutations. We may receive a commission for purchases made through these links at no extra cost to you. ISOGG 2019 Y-DNA Haplogroup Tree - International Society of Genetic Of course, if you're haplogroup G, it's pretty easy to just take a look without searching for each individual haplogroup. [21] In a study of 936 Indians, haplogroup G made up less than 1% of the sample and was completely absent in the tested Northwestern Indian population. [29][30][31] 3% of North African Berbers were found to be haplogroup G.[32] 2% of Arab Moroccans and 0.8% of Berber Moroccans were likewise found to be G.[33]. A haplotype is a group of alleles in an organism that are inherited together from a single parent, [1] [2] and a haplogroup ( haploid from the Greek: , haplos, "onefold, simple" and English: group) is a group of similar haplotypes that share a common ancestor with a single-nucleotide polymorphism mutation. Beginning in 2008, additional G SNPs were identified at Family Tree DNA (L designations) and Ethnoancestry (S designations). __ATA.criteo = __ATA.criteo || {}; Haplogroup G - Genealogy Wise In Europeexcept in Italy G2a2b1 constitutes less than 20% of G samples. In the Greek island of Crete, approximately 7%[18] to 11%[19] of males belong to haplogroup G. G U1 (the haplogroup of John Tobin, whose recent ancestry is from Co. Cork in Ireland) G (L497/CTS 1899) Who probably lived about 10,000 years ago in south or central Europe and was ancestor of: G (CTS9737) Ancestor of: G (Z725/CTS11352) Ancestor of: G (L43), who probably lived in Europe about 4,700 years ago. By tracking these changes, we constructed a family tree of humankind where all male lineages trace back to a single common ancestor who lived hundreds of thousands of years ago. A haplogroup is a genetic population sharing a common ancestor either on their direct patrilineal or direct matrilineal tree. the G (Z726/CTS6796)ancestors of Jack Fletcher 311504, whose ancestors were Furchers from an as yet unknown location in Germany; Sam Shaver 198471 and Gary Shaver N2302 from Unterheinriet near Stuttgart in Baden-Wrttemberg, and Jrgen Frster E14143 and Rick Foster 214036, from Schnberg-Ortmannsdorf, Zwichau, Saxony. ); oneSignal_options['allowLocalhostAsSecureOrigin'] = true; Adolph on 28 October 1707 in Huttenhofen. G (S23438) (see below) oneSignal_options['promptOptions']['siteName'] = "Italian Genealogy"; oneSignal_options['path'] = "https://www.italiangenealogy.blog/wp-content/plugins/onesignal-free-web-push-notifications/sdk_files/"; Heidelbergensis people in Europe, probably including those at Happisburg, Norfolk, about 950,000 years ago, ancestors of: Heidelbergensis people in Asia, ancestors of: Denisovans, who evolved in Asia and interbred with the later. So my north German ancestors closes matches appear to be German and Dutch (and Margraten is only about 80 miles west of where my ancestors lived in Germany). It was found with burial artifacts belonging to the Linearbandkeramische Kultur ("Linear Band Ceramic Culture"; LBK). He was born on 11 December 1882 and married Angela Mary Havers(a descendant of Thomas Cromwell and of the Jermyns) on 19 October 1909 at the Virgo Fidelis Convent in Upper Norwood, Surrey. Generally speaking, U4 is more common in Baltic and Slavic countries and around the Caucasus than anywhere else. It was then learned that several subclades belong under L223, including: G-L91 was identified in 2009. 3. Men with the haplogroup G marker moved into Europe in Neolithic times. The only regions where haplogroup G2 exceeds 10% of the population in Europe are in Cantabria in northern Spain, in northern Portugal, in central and southern Italy (especially in the Apennines), in Sardinia, in northern Greece (Thessaly), in Crete, and among the Gagauzes of Moldova all mountainous and relatively isolated regions. Among Jews in Israel drawn from many areas of the world, G-M377 constituted 3.7% in one study. The man who is the most recent common ancestor of this line is estimated to have been born around 3500 BCE. Digora, North Ossetia has the highest known concentration of G in a single city, as 74% of the tested men were G.[14] Haplogroup G is found as far east as northern China in small percentages where G can reach more substantial percentages in minority groups such as the Uyghurs. Men who belong to this group but are negative for all its subclades represent a small number today. HI Peter thanks for the quick response. The G-M286 subclade (M286+) is small compared with G-L91. "cb":b;l++;var c="callback__"+g().toString(36)+"_"+l.toString(36);a=k(a,b,c);window[c]=function(d){t(void 0,d)};m(a,function(d){d&&t(d)})})(y+"? Whoever he was, he had the first name Adolph (which is either from the German adel meaning noble and wolf, as used by the Visigothic king, Attaulf, who was murdered in AD 415, or from the Greek adelphos, meaning brother). The male-line ancestor ofDaniel Correll, who was born in1848 in Muncie, Pennsylvania and whose descendantRobert Correll tested positive for G-M201 (by a complete coincidence, Robert also tested positive for K1a on his mothers side, making him a cousin of Ozti through that route too). Maria Barbara, baptized on 7 December 1702 in Oberhattert. He married Agnes Cherrier and had children Gladys, Margaux and: Guillaume Adolph Haplogroup Matching: What It Does (and Doesn't) Mean G-L13 's paternal line was formed when it branched off from the ancestor G-FGC31390 and the rest of mankind around 8550 BCE. Italian DNA - Haplogroups - Italian Genealogy Haplogroup - Wikipedia C (M217), Chinese, Mongols (including Genghis Khan) and many native Americans. documentInitOneSignal(); gtag('config', 'UA-130175854-2'); The G-L13 Story. oneSignal_options['notifyButton']['theme'] = 'default'; These subgroups are referred to as subclades. Most Italian males come from Haplogroup R1b. [7], (Subclades here conform to the Y-DNA SNP definitions used by ISOGG In 2012, several categories found only in one man in research studies were removed from the ISOGG tree causing some renaming. Rarely would I do this for one company, but they give such an enormous amount of data, and roll out new data and features rapidly. Meanwhile, the site will be offline until April 15th 2023 to allow us to make the changes necessary. FamilyTreeDNA Discover - Y-DNA Haplogroup G-FTC74687 He was born in 1892 in Hove, Sussex. He died on 22 June 1868 at Maitland Park, Hampstead, London. Macerio Hay May 2017. Genetic genealogy reveals true Y haplogroup of House of Bourbon contradicting recent identification of the presumed remains of two French Kings Maarten H D Larmuseau, Philippe Delorme, Patrick. The most likely estimate is 1613 CE, rounded to 1600 CE. Mike Moose, whose Mussgung ancestry may provide an indication of where Z726 originated. ga.src = ('https:' === document.location.protocol ? He married Maria Gertrude Fischer. The only exceptions are the Caucasus region, central and southern Italy and Sardinia, where frequencies typically range from 15% to 30% of male lineages. Johann Weigand Adolph, baptized on 21 February 1708 in Daaden. G-CTS2488 or G2a2b2 (also known as G-L141.1; previously G-141 and G2a3b) was identified only in mid-2009 at Family Tree DNA. oneSignal_options['notifyButton']['position'] = 'bottom-left'; Knowing your haplogroup allows you to know what route your ancestors took from Africa to various places throughout history. This site contains affiliate links to products. OneSignal.SERVICE_WORKER_PARAM = { scope: "/" }; Haplogroup U1 is a rare lineage very homogeneously spread across most of Central Asia, Europe, the Middle East and North Africa, with a frequency typically ranging from 0.5% to 2%. There are 64 DNA tested descendants, and they specified that their earliest known origins are from United States, Germany, France, and 11 other countries. Hi. P287 was identified at the University of Arizona and became widely known in late 2007. G2a2b1 is more common in southern Europe than northern Europe. [44] The "U" SNPs were identified in 2006 but not published until 2009.[45]. Its identification caused considerable renaming of G categories. The oldest skeletons confirmed by ancient DNA testing as carrying haplogroup G2a were five found in the Avellaner cave burial site, near Les Planes d'Hostoles, in Catalonia, Spain and were dated by radiocarbon dating to about 5000 BCE. Men from the Caucasus and men from eastern Europe also form distinctive STR clusters. __ATA.cmd = __ATA.cmd || []; window._oneSignalInitOptions = oneSignal_options; So far all G2a1 persons have a value of 10 at STR marker DYS392. Bedtime now. He celebrated his 90th birthday in 2015 (congratulations!). (2004) suggested the mutation took place only 9,500 years ago. The registers of Altenkirchen have been destroyed by Allied bombing. He had children Marcel, Gerald, Ginette and (the oldest): Cecil Edward Adolph It has been found in Mexican mestizos. Even more G SNPs were identified in 2009 to 2012 leading to more changes. William Adolph (whose son Peter Adolph invented the Subbuteo table football game) })(); var ga = document.createElement('script'); ga.type = 'text/javascript'; ga.async = true; L223 is found on the Y chromosome at rs810801 and 6405148 with a mutation from C to G. L223 was first identified in samples at 23andMe in 2009 but proved problematic as an individual test, the first successful results being reported at Family Tree DNA in late 2011 under its assigned L223 label. G-M201 is most commonly found among various ethnic groups of the Caucasus, but is also widely distributed at low frequencies among ethnic groups throughout Europe, South Asia, Central Asia, and North Africa. . This value of 12 is uncommon in other G categories other than G1. In the Russian North Caucasus the Kabardinian and Ossetian populations are also notable for high rates of G-M201. 2. He was the ancestor of everyone carrying the G(L1259) marker alive today. Men and their male descendants belonging to a Y-DNA haplogroup are closely related to each other on the patrilineal (father-to-son only) side. Hi, I traced my ancestry back to Capt. Basically, haplogroups refer to organisms that have a common ancestor, identified by studying the nucleotide and mitochondrial mutations in cells. For the human mtDNA haplogroup, see. oneSignal_options['appId'] = 'b09f7512-2da9-4639-8b81-2797b69845f0'; G2a was found in medieval remains in a 7th- century CE high-status tomb in Ergolding, Bavaria, Germany, but G2a subclades were not tested.[34]. var __ATA = __ATA || {}; Report an Issue | G2a migrants must therefore have moved directly from Anatolia or the Caucasus to central and western Europe, in all likelihood invited by Indo-European rulers. This narrative pedigree picks up the story with: Homo Erectus, who evolved out of earlier homo species (and thus from earlier mammals, cynodonts, labyrinthodonts, fish, worms and ultimately single-celled life-forms), perhaps in the Caucasus, about 1.8 million years ago, ancestor of: Homo Heidelbergensis, who evolved in Africa about 1 million years ago, ancestor of: Heidelbergensis people in Africa, who were ancestors of: A00 (AF6/L1284), an archaic human male in Africa more than 200,000 years ago, in whose Y chromosome the A00 (AF6/L1284) genetic mutation arose, ancestor of: Homo sapiens, who evolved in Africa about 200,000 years ago, ancestors of the Mitochondrial Eve (who lived about 140,000 years ago and is now ancestor of all living humans through the female line) and of: A0-T (L1085) the Genetic Adam (descended in the female line from the Mitochondrial Eve), an early Homo sapiens who lived in Africa about 80,000 years ago, ancestor of: Adam, albeit of the Biblical rather than the genetic variety. Adolph and haplogroup G genealogy - Anthony Adolph DNA testing is a wonderful, new way of tracing your family tree far back beyond what can be achieved using oral history and written records. Haplogroup Story The Y chromosome is passed from father to son remaining mostly unaltered across generations, except for small traceable changes in DNA. G (L43), who probably lived in Europe about 4,700 years ago. L353_1, L353_2 has been found to be an unreliable palindromic snp; withdrawn from the tree on 11 December 2013. Bockenhen was almost certainly Bochenheim, sometimes called Stein-Bockenheim, about thirty kilometers south-west of Mainz. He had children including: Peter Joseph Adolph ISOGG 2013 Y-DNA Haplogroup G - International Society of Genetic Genealogy oneSignal_elements[i].addEventListener('click', oneSignalLinkClickHandler, false); He was born at Volkerzen on 6 June 1778 and this was recorded at Hilgenroth. G-M406* (G2a2b1*; previously G2a3a*) and its subclades seem most commonly found in Turkey and the coastal areas of the eastern Mediterranean where it can constitute up to 5% of all makes and 50% of haplogroup G samples. This is likely due to a local founder effect.[40]. DNA from 459 Ancient British Isles Burials Reveals - Genetic Genealogy These are found at: rs9786910, rs9786537, rs2713254, rs35567891 and rs34621155 on the Y chromosome. display: none; They had children including: 1. I will hunt down my haplogroup G information tomorrow. The overwhelming majority of Europeans belong to the G2asubclade, and most northern and western Europeans fall more specifically within G2a-L140(or to a lower extend G2a-M406). L141 persons who do not belong to any L141 subclade so far have the value of 11 at STR marker DYS490 a finding rare in other G categories. They arewith accompanying Y-chromosome locationsU5 (rs2178500), L149 (8486380) and L31 (also called S149) (rs35617575..12538148). A separate study on the Argyns found that 71% of males belong to G1. U4 is only found at trace frequencies in North Africa. The original entry reads : Anna Barbara Adolph baptised on 6 January 1714 Muschenbach and in Marienstat. oneSignal_options['wordpress'] = true; function r(a,b,c){b=void 0===b? He and his unknown wife had children: Johannes Peter Adolph Among Turkish males 11% of the population is G.[6] In Iran, Haplogroup G reaches 13 to 15% of the population in various parts of the country. 2004). ), Ancient G-M201s with sequencing[self-published source?] I shall update this page in due course (but as soon as it is update, they will probably come along and make more refinements! (function(){var g=Date.now||function(){return+new Date};function h(a,b){a:{for(var c=a.length,d="string"==typeof a?a.split(""):a,e=0;eb?null:"string"==typeof a?a.charAt(b):a[b]};function k(a,b,c){c=null!=c? G-M201 is most commonly found among various ethnic groups of the Caucasus, but is also widely distributed at low frequencies among ethnic groups throughout Europe, South Asia, Central Asia, and North Africa. In order to determine if one of these alternative SNPs represents a subclade of M201, the alternative SNPs must be tested in G persons who are negative for the known subclades of G. There are only a tiny number of persons in such a category, and only a tiny number of persons have been tested for G equivalent SNPs other than M201. He is the ancestor of at least 3 descendant lineages known as G-Z2022, G-L1354 and 1 yet unnamed . The male lineage of the medieval Bure kinship from Sweden has been identified as Y-DNA haplogroup G2a, based on several BigY tests carried out in 2014 on people living today. G-L140 (Y-DNA) - Geni Haplogroup G2a2b is a rare group today in Europe. 1. A relatively high percentage of G2a2b1 persons have a value of 21 at STR marker DYS390. How to Find Your Y-DNA and mtDNA Haplogroups - Genealogy Explained He married first, before 1732, to Marie Elisabeth Schmidt, and secondly on 21 October 1733, to Maria Elisabeth Baumeister and they were parents of: Johannes Carl Adolph The Duchess of Cambridge) on 17 September 1937 at St Mary, Croydon, Surrey and secondly to Gwendolen Mary Stepney on 31 January 1967.

Plutarch Life Of Alexander Sparknotes, Equestrian Communities In Kentucky, 13 Dpo Symptoms Before Bfp, What Did The Menendez Brothers Parents Do To Them, Tuscany Faucets Customer Service, Articles H